Loren Data's SAM Daily™

fbodaily.com
Home Today's SAM Search Archives Numbered Notes CBD Archives Subscribe
SAMDAILY.US - ISSUE OF AUGUST 22, 2024 SAM #8304
SPECIAL NOTICE

Q -- Notice of Intent to Sole Source: Generating a THP1 reporter cell line and a 802-30F cell line for high-throughput screening

Notice Date
8/20/2024 9:03:27 AM
 
Notice Type
Special Notice
 
NAICS
541380 — Testing Laboratories
 
Contracting Office
NATIONAL INSTITUTES OF HEALTH NIDA Bethesda MD 20892 USA
 
ZIP Code
20892
 
Solicitation Number
75N95024Q00532
 
Response Due
8/23/2024 9:00:00 AM
 
Archive Date
09/07/2024
 
Description
INTRODUCTION THIS IS A PRE-SOLICITATION NON-COMPETITIVE (NOTICE OF INTENT) SYNOPSIS TO AWARD A CONTRACT WITHOUT PROVIDING FOR FULL OR OPEN COMPETITION (INCLUDING BRAND-NAME). The National Institute on Drug Abuse (NIDA), Office of Acquisition (OA) the National Center for Advancing Translational Sciences (NCATS), intends to negotiate and award a purchase order without providing for full and open competition (including brand-name) to EditCo Bio 600 Saginaw DriveRedwood City, CA 94063 for custom lab services for Generating a THP1 reporter cell line and a 802-30F cell line for high-throughput screening. NORTH AMERICAN INDUSTRY CLASSIFICATION SYSTEM (NAICS) CODE and SET ASIDE STATUS The intended procurement is classified under NAICS code 541380 Testing Laboratories and Services with a Size Standard of $16.50. � REGULATORY AUTHORITY This acquisition is conducted under the authority of the Federal Acquisition Regulation (FAR) Part 13�Simplified Acquisition Procedures. Contracts awarded using FAR Part 13�Simplified Acquisition Procedures are exempt from the requirements of FAR Part 6�Competition Requirements. FAR Subpart 13.106-1 (b) Soliciting from a single source provides that: For purchases not exceeding the simplified acquisition threshold, Contracting officers may solicit from one source IF the contracting officer determines that the circumstances of the contract action deem only one source reasonably available (e.g., urgency, exclusive licensing agreements, brand-name OR industrial mobilization). The resultant contract will include all applicable provisions and clauses in effect through the Federal Acquisition Circular (FAC) 2022-08 dated October 22, 2022. DESCRIPTION OF REQUIREMENT PURPOSE AND OBJECTIVES: The purpose of this project is to generate THP1 and 802-30F cell lines expressing pro-inflammatory signaling reporters (IL6, CXCL10) fused to a HiBiT luminescent tag. Contractor will use CRISPR/Cas9 to engineer a HiBiT tag into IL6 and CXCL10 loci. Five pools will be generated. IL6 (P05231) https://www.uniprot.org/uniprotkb/P05231/entry KI location:� Between Pro29 and Val30 KI sequence: VSGWRLFKKISGGGS Gene:� IL6 (P05231) https://www.uniprot.org/uniprotkb/P05231/entry KI location:� Cterm, following Met212 KI sequence: GGGSVSGWRLFKKIS(STOP) Gene:� CXCL10 (P02778) https://www.uniprot.org/uniprotkb/P02778/entry KI location:� Between Gly21 and Val22 KI sequence: VSGWRLFKKISGGGS Gene:� CXCL10 (P02778) https://www.uniprot.org/uniprotkb/P02778/entry KI location:� Cterm, following Pro98 KI sequence: GGGSVSGWRLFKKIS(STOP) Gene:� IL6 KI location:� Cterm, KI sequence: GGCGGCGGCAGCGTGAGCGGCTGGCGCCTGTTTAAAAAAATTAGC ESTIMATED PERIOD OF PERFORMANCE: 15 weeks ARO CONTRACTING WITHOUT PROVIDING FOR FULL OR OPEN COMPETITION (INCLUDING BRAND-NAME) DETERMINATION The determination by the Government to award a contract without providing for full and open competition is based upon the market research conducted. Specifically, EditCo Bio 600 Saginaw DriveRedwood City, CA 94063 is the only vendor in the marketplace that can provide the services required by NIDA . The intended source is: EditCo Bio 600 Saginaw DriveRedwood City, CA 94063 CLOSING STATEMENT THIS SYNOPSIS IS NOT A REQUEST FOR COMPETITIVE PROPOSALS. However, interested parties may identify their interest and capability to respond to this notice. A determination by the Government not to compete this proposed contract based upon responses to this notice is solely within the discretion of the Government. All responsible sources may submit a capability statement, proposal, or quotation which shall be considered by the agency. The information received will normally be considered solely for the purposes of determining whether to proceed on a non-competitive basis or to conduct a competitive procurement. Responses to this notice shall contain sufficient information to establish the interested parties' bona-fide capabilities for fulfilling the requirement and include: unit price, list price, shipping and handling costs, the delivery period after contract award, the prompt payment discount terms, the F.O.B. Point (Destination or Origin), the Unique Entity ID (UEI), the Taxpayer Identification Number (TIN), and the certification of business size. All offerors must have an active registration in the System for Award Management (SAM) www.sam.gov. All responses must be received by the closing date and time of this announcement and must reference the solicitation number, 75N95024Q00532. Responses must be submitted electronically to Kaitlyn Landi, Contract Specialist, at kaitlyn.landi@nih.gov and KJ Shaikh, Contracting Officer, at kj.shaikh@nih.gov.� U.S. Mail and fax responses will not be accepted.
 
Web Link
SAM.gov Permalink
(https://sam.gov/opp/9ab222d39dca4e8b90b971c18e5153cf/view)
 
Record
SN07177325-F 20240822/240820230116 (samdaily.us)
 
Source
SAM.gov Link to This Notice
(may not be valid after Archive Date)

FSG Index  |  This Issue's Index  |  Today's SAM Daily Index Page |
ECGrid: EDI VAN Interconnect ECGridOS: EDI Web Services Interconnect API Government Data Publications CBDDisk Subscribers
 Privacy Policy  Jenny in Wanderland!  © 1994-2024, Loren Data Corp.