Loren Data's SAM Daily™

fbodaily.com
FBO DAILY - FEDBIZOPPS ISSUE OF SEPTEMBER 13, 2015 FBO #5042
SOLICITATION NOTICE

B -- Genome Editing Testing Services

Notice Date
9/11/2015
 
Notice Type
Combined Synopsis/Solicitation
 
NAICS
541380 — Testing Laboratories
 
Contracting Office
Department of Health and Human Services, National Institutes of Health, National Institute on Drug Abuse, 6001 Executive Boulevard, Room 4211 - MSC 9559, Bethesda, Maryland, 20892, United States
 
ZIP Code
20892
 
Solicitation Number
HHS-NIH-NIDA(SSSA)-2015-CSS-823
 
Archive Date
10/3/2015
 
Point of Contact
Samantha A. Kelly, Phone: 3014028855
 
E-Mail Address
samantha.kelly2@nih.gov
(samantha.kelly2@nih.gov)
 
Small Business Set-Aside
N/A
 
Description
Combined Synopsis / Solicitation Title: Genome Editing Testing Services (i)This is a combined synopsis/solicitation for commercial items prepared in accordance with the format in Subpart 12.6 as supplemented with additional information included in this notice. This announcement constitutes the only solicitation; proposals are being requested and a written solicitation will not be issued. (ii)The solicitation number is HHS-NIH-NIDA(SSSA)-2015-CSS-823 and the solicitation is issued as a request for quotation (RFQ). This acquisition is for a commercial item or service and is conducted under the authority of the Federal Acquisition Regulation (FAR) Part 13-Simplified Acquisition Procedures; and FAR Part 12-Acquisition of Commercial Items, and is not expected to exceed the simplified acquisition threshold. (iii)The solicitation document and incorporated provisions and clauses are those in effect through Federal Acquisition Circular 2005-84, dated September 3, 2015. (iv)This acquisition is unrestricted, open market competition. The associated NAICS code 541380 - Testing Laboratories and the small business size standard is $15 Million. (v)Genome Editing Testing Services (vi)Background The National Institutes of Health (NIH) is the nation's leading medical research agency and the primary Federal agency whose mission is to seek fundamental knowledge about the nature and behavior of living systems and the application of that knowledge to enhance health, lengthen life, and reduce illness and disability, conducting, supporting and making medical discoveries that improve people's health and save lives. The National Center for Advancing Translational Sciences (NCATS) - one of 27 Institutes and Centers at the National Institutes of Health (NIH) - was established to transform the translational process so that new treatments and cures for disease can be delivered to patients faster. The NCATS mission is to catalyze the generation of innovative methods and technologies that will enhance the development, testing and implementation of diagnostics and therapeutics across a wide range of human diseases and conditions. The NCATS strives to develop innovations to reduce, remove or bypass costly and time-consuming bottlenecks in the translational research pipeline in an effort to speed the delivery of new drugs, diagnostics and medical devices to patients. CRISPR-based reagents are used for the gene specific knockout of genes in cells. They are needed to facilitate our RNAi screening program. This program is conducting genome-wide siRNA screens in collaboration with NIH intramural investigators. This work includes RNAi assay development, screening, and initial follow up. As such, discovering probe molecules that could serve as starting points for therapeutics in rare cancers is of great interest within NCATS. NCATS has several projects that address many aspects of oncology mechanisms and approaches to discovering novel, effective small molecules. Therefore, the NCATS is in need of genome editing testing services for a series of gRNAs. Purpose The purpose of this requirement is to procure testing services, using genome editing tools, to design 8 gRNAs and clone 65 gRNAs. Project Requirements The testing services will be used to confirm active gene hits identified from primary siRNA screens using the same assays. This is vital to help increase confidence in actives. The requirements for the testing services, using the genome editing tools, include the following: The following are the requirements of the project: 1.Contractor must use a genome editing tool that will include GFP and puromycin selection markers. 2.Contractor must use a genome editing tool that has the ability to generate knockout cell lines of choice for both in vitro and in vivo work, corresponding to the sequences chosen for knockout, thereby maintaining the continuity of research between the screening facility and the screening collaborator for purposes of validation. 3.Contractor must design 8 gRNAs for target sequence for use with wild type Cas9. The sequences for the following genes are listed below: Target GeneFull Sequence (PAM and flanking)Sequence to Order SMG1CGAATCTTCTTCGGAGGATCACCCGGGAAGTCTTCTTCGGAGGATCACCC EIF4A3AAGTGGAATTCGAGACCAGCGAGGAGGTGGGGAATTCGAGACCAGCGAGG RBM8ATGGCGGACGTGCTAGATCTTCACGAGGCTGGGACGTGCTAGATCTTCACG MAGOHTCTGCGTTACTACGTGGGGCACAAGGGCAACGTTACTACGTGGGGCACAA SMG6GACTCCTTAAGTAAGCAGGTGCAGCGGCGGCCTTAAGTAAGCAGGTGCAG CASC3GGCAGCGCGCTTCGCAAGACACCGAGGACGGCGCGCTTCGCAAGACACCG OR1G1TCCTGTTCATGTACTTGGTCACGGTGGCAGGTTCATGTACTTGGTCACGG ALUCGCCTGTAATCCCAGCACTTTGGGAGGCCGTGTAATCCCAGCACTTTGGG 4.Contractor must clone 65 gRNAs into an all in one plasmid expressing Cas9 and gRNA as well as a selection or fluorescent marker. For every plasmid that contains a particular guide, there must be a fluorescent marker or antibiotic marker that is added to the plasmid so that NCATS can select cells that express the guide either by fluorescence microscopy or by selection pressure using antibiotics. 5.Contractor must provide shipping and handling and deliver the designed and cloned gRNAs within 30 days after Contractor receipt of the purchase order. 6.Contractor must provide certificate of analysis and product inserts in the shipment. Anticipated Period of Performance and Place of Delivery: Delivery is anticipated within thirty days after receipt of the purchase order; period of performance will be defined upon award. (viii)The provision at FAR clause 52.212-1, Instructions to Offerors - Commercial Items, applies to this acquisition. (ix)The provision at FAR clause 52.212-2, Evaluation - Commercial Items, applies to this acquisition. (a)The Government will award a contract resulting from this solicitation to the responsible offeror whose offer conforming to the solicitation will be most advantageous to the Government, price and other factors considered, to include past performance. The technical factors together shall be considered more important than price. The Government intends to issue an award on a firm fixed price Contract for this requirement. The technical evaluation factors are as follows, in order of importance: Evaluation Criteria: 1.Factor 1: Technical Approach The Offeror shall detail in its technical proposal how it shall meet each of the project requirements. 2.Factor 2: Delivery The Offeror shall detail in its technical proposal how it shall meet the delivery requirements. The Government shall particularly evaluate ability to meet or exceed delivery schedule requirements. Quotations must include a delivery lead time. (b)Award Criteria Selection of an Offeror for the award will be on the basis of best value, technical factors and price considered. Technical acceptability includes an evaluation on technical factors (which encompasses experience/capability and past performance factors), and cost/price factors. Evaluation of technical acceptability will be made in accordance with the prospective Contractor's demonstrated capabilities of meeting each of the requirements as set forth in this solicitation and all applicable attachments. The merits of each proposal will be evaluated carefully. Offerors must include all specifications/services (including all brand-name or equal requirements so that the brand-name or equal status may be verified), detailed in this solicitation, in its proposal and must also include delivery lead time. Offerors cost/price proposal will be evaluated for reasonableness. For a price to be reasonable, it must represent a price to the Government that a prudent person would pay when consideration is given to prices in the market. Normally, price reasonableness is established through adequate price competition, but may also be determined through cost and price analysis techniques as described in FAR 15.404. A redacted invoice, from the current year, for similar requirements or a published price list is requested to determine price reasonableness. The prices quoted will be evaluated taking into consideration any price reductions. A best value analysis will be performed taking into consideration the results of the technical evaluation and price evaluation. (x)The provision at FAR clause 52.212-3, Offeror Representations and Certifications - Commercial Items, applies to this acquisition. (xi)FAR clause at 52.212-4, Contract Terms and Conditions - Commercial Items, applies to this acquisition. An addendum to FAR clause 52.212-4, Contract Terms and Conditions-Commercial Items applies to this acquisition. (xii)FAR clause at 52.212-5, Contract Terms and Conditions Required to Implement Statutes or Executive Orders-Commercial Items, applies to this acquisition. (xiv)The Defense Priorities and Allocations System (DPAS) are not applicable to this (xv)Responses to this solicitation must include sufficient information to establish the interested parties' bona-fide capabilities of providing the product or service. The price quote shall include: unit price, list price, fully loaded fixed hourly rate or each labor category, breakdown and rationale for other direct costs or materials, shipping and handling costs, delivery days after contract award, delivery terms, prompt payment discount terms, F.O.B. Point (Destination or Origin), product or catalog number(s); product description, the total cost; and any other information or factors that may be considered in the award decision. Such factors may include: past performance; special features required for effective program performance; trade-in considerations; probable life of the item selected as compared with that of a comparable item; warranty considerations; maintenance availability; and environmental and energy efficiency considerations. Responses to this solicitation must include clear and convincing evidence of the offerors' capability of fulfilling the requirement as it relates to the technical evaluation criteria and a price proposal. In addition the Dun & Bradstreet Number (DUNS), the Taxpayer Identification Number (TIN), and the certification of business size must be included in the response. All offerors must have an active registration in the System for Award Management (SAM) www.sam.gov. Questions regarding this combined synopsis/solicitation must be received in this office by 8:00AM (EST) on September 15, 2015. Offers must be received electronically by 8:00 AM (EST) on September 18, 2015. Facsimile submissions are not authorized and collect calls will not be accepted. Submit offers to: Samantha Kelly, Contract Specialist at Samantha.Kelly2@nih.gov Please reference the solicitation number HHS-NIH-NIDA-(SSSA)-CSS-15-823 on your offer. Requests for information concerning this requirement are to be addressed to Samantha Kelly via e-mail only to Samantha.Kelly2@nih.gov prior to the closing date for questions.
 
Web Link
FBO.gov Permalink
(https://www.fbo.gov/spg/HHS/NIH/NIDA-01/HHS-NIH-NIDA(SSSA)-2015-CSS-823/listing.html)
 
Record
SN03883387-W 20150913/150912000701-8022fdbd220d5d2e83b0a4fe6a8ad0ea (fbodaily.com)
 
Source
FedBizOpps Link to This Notice
(may not be valid after Archive Date)

FSG Index  |  This Issue's Index  |  Today's FBO Daily Index Page |
ECGrid: EDI VAN Interconnect ECGridOS: EDI Web Services Interconnect API Government Data Publications CBDDisk Subscribers
 Privacy Policy  Jenny in Wanderland!  © 1994-2026, Loren Data Corp.